Chinese Journal of Lasers, Volume. 47, Issue 5, 0507001(2020)
Correlation Analysis of Photosynthetic Physiological Indexes and Content of Fucoxanthin in Phaeodactylum tricornutum Under Different Light Quality Conditions
Figures & Tables(5)
Fig. 1. Effects of different monochromatic LED light qualities on the production of fucoxanthin and chlorophyll a in Phaeodactylum tricornutum. (CK: white light; R: red light; Y: yellow light; B: blue light; G: green light; P: purple light; * indicates a significant difference, P<0.05; ** indicates an extremely significant difference, P<0.01). (a) Fucoxanthin; (b) chlorophyll a
Fig. 2. Transcript levels induced by different light qualities in Phaeodactylum tricornutum (*indicates a significant difference, P<0.05; ** indicates an extremely significant difference, P<0.01). (a) rbcL; (b) fcpB; (c) psbA; (d) psaB
Table 1. Primers of target genes
View tableTable 1. Primers of target genes
Gene Gene code Primer sequences(5'-3') rbcL KY751726.1 TATTAACTCACAACCCTTCATGCG(F) TGAACCTTTAGTTTCACCTGTAGC(R) fcpB Z24768.1 ATGAAGTTTACCGTGTTTGCCT(F) TAACACCTGGGAGGATGTTGACTC(R) psaB KM009805.1 Caggtcgtggtggtacttgtgatat(F) Cgtagccagcccatgatgtaatttg(R) psbA KY751725.1 Caggtgtattcggtggttctttattct(F) Cgagagttgttaaatgaagcgtattgg(R)
Table 2. Effects of different monochromatic LED light qualities on chlorophyll fluorescence parameter expression in Phaeodactylum tricornutum
View tableTable 2. Effects of different monochromatic LED light qualities on chlorophyll fluorescence parameter expression in Phaeodactylum tricornutum
Light quality Y(II) qP NPQ rETRmax α CK 0.352±0.025** 0.692±0.028 0.145±0.009 38.490±2.673 0.227±0.008 R 0.514±0.006** 0.750±0.038 0.127±0.011 45.235±1.630** 0.289±0.006** Y 0.503±0.013** 0.555±0.025* 0.053±0.005** 34.083±1.210 0.259±0.007** B 0.393±0.006** 0.713±0.016 0.152±0.004 37.566±1.291 0.265±0.004** G 0.511±0.011** 0.669±0.024 0.082±0.018** 35.083±1.765 0.237±0.004* P 0.485±0.007** 0.593±0.051 0.063±0.010** 39.138±1.840 0.245±0.005**
Table 3. Correlation analysis of fucoxanthin content with chlorophyll fluorescence parameters and photosynthesis-related genes in Phaeodactylum tricornutum
View tableTable 3. Correlation analysis of fucoxanthin content with chlorophyll fluorescence parameters and photosynthesis-related genes in Phaeodactylum tricornutum
Iterm Fucoxanthin Chlorophyll a Y(II) qP NPQ rETRmax α rbcL fcpB psbA psaB Fucoxanthin 1 Chlorophyll a 0.352 1 Y(II) 0.310 -0.152 1 qP -0.188 0.007 -0.148 1 NPQ -0.257 0.293 -0.715** 0.677** 1 rETRmax 0.539* 0.636** 0.047 0.444 0.377 1 α 0.004 0.502* 0.472* 0.396 0.097 0.511* 1 rbcL -0.650** -0.650** 0.055 -0.147 0.406 -0.449 -0.397 1 fcpB 0.580* -0.145 0.050 -0.410 0.010 -0.410 -0.551* -0.145 1 psbA -0.431 -0.431 -0.473* 0.096 0.438 -0.470* -0.744** 0.675** 0.418 1 psaB 0.007 0.007 -0.858** -0.171 -0.598** -0.431 -0.259 -0.462 -0.281 0.033 1
Tools
Get Citation
Copy Citation Text
Runjie Xu, Yifu Gong, Fengjuan Wei, Shenrui Li, Ruoying Chen, Xiaoyun Zheng, Qingshu Fang, Wenting Cheng, Heyu Wang. Correlation Analysis of Photosynthetic Physiological Indexes and Content of Fucoxanthin in Phaeodactylum tricornutum Under Different Light Quality Conditions[J]. Chinese Journal of Lasers, 2020, 47(5): 0507001
Paper Information
Category: biomedical photonics and laser medicine
Received: Dec. 18, 2019
Accepted: Jan. 10, 2020
Published Online: May. 12, 2020
The Author Email: Yifu Gong (gongyifu@163.com)
© Copyright 2018-2021 | Chinese Laser Press.
All Rights Reserved 沪ICP备15018463号-20