Journal of Resources and Ecology, Volume. 11, Issue 5, 466(2020)
Genetic Diversity of Toona ciliata Populations based on SSR Markers
Figures & Tables(8)
Table 1.
Locations and altitudes of the 24 sampled populations of Toona ciliata
View tableView in ArticleTable 1.
Locations and altitudes of the 24 sampled populations of Toona ciliata
Population Location East longitude North latitude Altitude (m) Population Location East longitude North latitude Altitude (m) P1 Xingyi of Guizhou 105°02°08 24°58°03 779 P13 Laifeng of Hubei 109°15°57 29°25°58 521 P2 Changde of Hunan 111°31°08 29°18°54 399 P14 Hefeng of Hubei 110o12°29 30o10°12 559 P3 Ceheng of Guizhou 105°52°38 24°52°16 972 P15 Enshi of Hubei 109°14°51 30°01°13 738 P4 Tianlin of Guangxi 106°39°08 24°02°12 311 P16 Xuan’en of Hubei 109°41°59 30o02°26 1013 P5 Shaoyang of Hunan 111°22°15 27°22°30 540 P17 Lichuan of Hubei 108°33°49 29°51°22 521 P6 Jinggangshan of Jiangxi 114°09°37 26°39°20 907 P18 Zhushan of Hubei 110°01°59 31°39°58 660 P7 Zhenfeng of Guizhou 105°46°17 25°22°46 477 P19 Gucheng of Hubei 111°15°49 32°01°36 402 P8 Huaihua of Hunan 110°05°14 27°31°47 613 P20 Badong of Hubei 110°23°44 30°36°49 720 P9 Anlong of Guizhou 105°26°25 25°06°23 1377 P21 Chongyang of Hubei 113°46°25 29°26°37 338 P10 Youmai of Guizhou 105°59°41 25°03°19 695 P22 Tongshan of Hubei 114°38°39 29°24°18 567 P11 Xian°an of Hubei 114°19°18 29°45°42 356 P23 Huangshi of Hubei 115°04°51 30°11°26 356 P12 Xianfeng of Hubei 109°00°07 29°47°59 806 P24 Jianshi of Hubei 110°05°59 30°19°26 541
Table 2.
Primer sequences used in the SSR analysis of T. ciliata
View tableView in ArticleTable 2.
Primer sequences used in the SSR analysis of T. ciliata
Primer Primer combination sequences S5 F: GTGGCGTAACAGACCAAAAC R: CCAGAGATACTCCATTCCAG S11 F: AGTAATAGCCTGTAGAGCAG R: GAAGAAGGGTGAGCGAGA S22 F: GAAACCAGCAGGCAGAGC R: ACCGCATTAGTACCAGTAG T02 F: TAGGAAAGGCAAGGTGGG R: GGGTGGTCGATGAGGGTT T05 F: AGTAATAGCCTGTAGAGCAG R: AGAGTGGGGTGGTCGATGAG T07 F: ATGGATGAGTGTGCGATAGG R: TGTGATGTAGGAGTCTGAAC S422 F: ATGGATGAGTGTGCGATAGG R: TGTGATGTAGGAGTCTGAAC
Table 3.
Summary of genetic variation statistics of the seven Loci
View tableView in ArticleTable 3.
Summary of genetic variation statistics of the seven Loci
Locus Na Ne PPB (%) PIC Ho He H I S5 2 2.1460 89.30 0.5340 0.0000 0.4444 0.4401 0.6603 S11 4 3.9574 75.20 0.7473 0.0870 0.6749 0.6675 1.2094 S22 2 1.7950 86.63 0.4429 0.0000 0.4266 0.4228 0.6205 T02 2 1.4102 93.53 0.2909 0.5965 0.4695 0.4654 0.1447 T07 3 2.3750 63.50 0.5789 0.0192 0.4796 0.4750 0.8395 T05 2 2.0880 93.70 0.5211 0.0000 0.4708 0.4664 0.6757 S422 4 2.0498 49.92 0.5122 0.0357 0.5037 0.4992 0.9745 Mean 2.7143 2.2602 78.82 0.5182 0.1055 0.4956 0.4909 0.7321
Table 4.
Genetic diversity parameters of 24 T. ciliata populations
View tableView in ArticleTable 4.
Genetic diversity parameters of 24 T. ciliata populations
Population Na Ne PIC Ho He H I P1 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P2 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P3 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P4 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P5 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P6 2.2857 1.8138 100.00% 0.0714 0.4481 0.4107 0.6533 P7 1.1429 1.1429 14.29% 0.1429 0.0952 0.0714 0.0990 P8 1.2857 1.1829 28.57% 0.0357 0.1310 0.1027 0.1528 P9 1.1667 1.1000 14.29% 0.0833 0.0714 0.0625 0.0937 P10 1.2857 1.2101 28.57% 0.0857 0.1302 0.1171 0.1705 P11 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P12 1.1429 1.1213 14.29% 0.1020 0.0706 0.0656 0.0931 P13 1.4286 1.2527 42.86% 0.2381 0.1810 0.1508 0.2278 P14 1.0000 1.0000 0.00% 0.0000 0.0000 0.0000 0.0000 P15 1.2857 1.2857 28.57% 0.2857 0.2857 0.1429 0.1980 P16 2.4286 2.2286 0.00% 0.1429 0.6190 0.5159 0.8015 P17 1.0000 1.0000 0.00% 0.0000 0.0000 0.0000 0.0000 P18 1.1429 1.1143 14.29% 0.0952 0.0762 0.0635 0.0909 P19 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P20 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 P21 1.0000 1.0000 0.00% 0.0000 0.0000 0.0000 0.0000 P22 1.2857 1.1708 28.57% 0.0857 0.1175 0.1057 0.1588 P23 1.1429 1.0857 14.29% 0.0714 0.0714 0.0536 0.0803 P24 1.1429 1.1429 14.29% 0.1429 0.1429 0.0714 0.0990 Mean 1.2629 1.2081 19.05% 0.1136 0.1493 0.1044 0.1546
Table 5.
Coefficients of genetic differentiation and gene flow between T. ciliata populations
View tableView in ArticleTable 5.
Coefficients of genetic differentiation and gene flow between T. ciliata populations
Locus Fis Fst Nm S5 1.0000 0.9148 0.0233 S11 -0.1232 0.8288 0.0516 S22 1.0000 0.9148 0.0233 T02 -0.7084 0.2374 0.8029 T07 0.7857 0.8233 0.0537 T05 1.0000 0.8921 0.0302 S422 0.6548 0.7914 0.0659 Mean -0.0096 0.7727 0.0735
Table 6.
Geographic distance and Nei’s measures of genetic distance between the different populations
View tableView in ArticleTable 6.
Geographic distance and Nei’s measures of genetic distance between the different populations
Population P1 P2 P3 P 4 P5 P 6 P7 P8 P9 P10 P11 P12 P1 0.000 0.184 0.000 0.169 0.164 1.427 0.023 0.191 0.048 0.020 1.250 1.495 P2 813.899 0.000 0.502 0.284 0.224 0.000 0.253 0.136 0.321 0.355 0.151 0.397 P3 94.239 745.562 0.000 0.134 0.238 1.499 0.087 0.624 0.010 0.079 1.559 0.914 P4 200.399 764.182 121.327 0.000 0.261 0.379 0.357 0.191 0.321 0.251 0.679 0.759 P5 694.831 216.008 615.055 600.545 0.000 0.128 1.861 0.076 0.321 0.251 0.151 0.397 P6 942.630 394.233 854.178 809.441 288.084 0.000 0.594 0.220 1.261 1.101 0.100 0.317 P7 94.373 717.911 58.421 174.249 600.937 851.510 0.000 1.852 1.826 0.001 1.482 1.338 P8 588.999 244.576 513.711 518.222 128.105 415.348 491.837 0.000 0.273 0.250 0.150 1.033 P9 51.623 764.833 51.287 170.344 643.819 890.660 46.619 536.283 0.000 0.011 1.826 1.624 P10 105.825 719.245 28.112 130.579 595.541 937.695 43.327 491.987 56.546 0.000 1.378 1.329 P11 1102.194 295.379 1031.610 1033.003 438.119 409.258 1006.608 518.472 1051.834 1009.778 0.000 0.092 P12 667.923 249.735 627.351 679.819 354.799 614.673 584.291 273.074 628.524 603.785 518.927 0.000 P13 658.233 215.922 610.919 655.850 306.996 569.457 570.941 227.165 615.754 587.346 496.102 47.796 P14 784.345 155.414 734.238 772.719 331.558 547.032 685.329 297.541 740.855 710.735 390.338 131.978 P15 702.516 233.378 660.920 711.379 351.351 608.949 618.035 288.427 662.272 637.127 491.349 34.232 P16 731.596 193.604 686.204 730.671 337.601 576.007 645.371 280.881 690.102 662.422 447.588 32.267 P17 648.599 292.523 612.780 672.126 388.540 653.713 567.327 297.783 610.703 662.329 559.069 43.109 P18 896.381 298.413 859.041 911.302 494.726 686.210 814.512 460.657 858.245 835.246 435.728 231.839 P19 997.076 302.490 952.453 995.339 516.427 659.615 911.266 511.782 955.825 928.686 348.442 328.029 P20 824.102 180.008 777.377 817.424 371.063 572.418 737.151 343.091 782.254 753.221 379.222 161.860 P21 1004.299 222.903 932.128 926.337 329.956 305.026 910.554 418.748 955.163 910.704 117.445 467.081 P22 1078.720 303.619 1003.264 992.667 391.714 308.371 984.091 492.168 1028.344 982.642 108.409 548.314 P23 1154.471 357.847 1082.811 1077.884 477.909 401.988 1060.605 569.301 1105.364 1061.561 73.747 588.123 P24 789.9930 174.5340 742.3150 783.321 351.456 409.226 702.080 314.612 747.541 718.582 399.826 129.477 Population P13 P14 P15 P16 P17 P18 P19 P20 P21 P22 P23 P24 P1 1.321 1.320 1.411 1.550 1.398 1.254 1.283 1.279 1.264 1.260 1.339 1.269 P2 0.353 0.147 0.376 0.514 0.315 0.547 0.540 0.184 0.081 0.087 0.103 0.208 P3 1.506 1.234 1.006 0.503 1.075 1.176 0.903 0.645 0.549 0.504 0.538 0.527 P4 0.671 0.484 0.515 0.565 0.372 0.461 0.460 0.349 0.266 0.345 0.342 0.582 P5 1.321 0.670 0.716 0.565 0.996 0.893 0.789 0.338 0.166 0.139 0.136 0.423 P6 0.266 0.330 0.262 0.317 0.354 0.368 0.379 0.272 0.114 0.125 0.120 0.305 P7 0.172 1.322 1.322 0.249 1.349 1.338 1.337 1.337 1.349 2.305 1.340 1.337 P8 0.668 0.725 0.080 0.564 0.514 0.526 0.553 0.191 0.135 0.063 0.128 0.289 P9 2.477 1.784 2.050 1.641 1.636 2.635 2.624 1.672 1.636 1.670 1.839 0.981 P10 1.299 0.935 1.314 1.719 1.866 1.329 1.328 1.328 1.866 2.285 1.331 1.328 P11 0.100 0.103 0.096 0.092 0.093 0.097 0.123 0.138 0.156 0.087 0.093 0.092 P12 0.090 0.089 0.090 0.090 0.090 0.090 0.097 0.093 0.097 0.091 0.095 0.100 P13 0.000 0.097 0.097 0.090 0.091 0.092 0.089 0.102 0.107 0.111 0.103 0.091 P14 126.121 0.000 0.092 0.091 0.094 0.088 0.089 0.236 0.094 0.107 0.114 0.091 P15 62.808 43.537 0.000 0.091 0.094 0.092 0.093 0.236 0.094 0.093 0.100 0.090 P16 75.212 59.243 43.576 0.000 0.091 0.095 0.099 0.233 0.099 0.116 0.118 0.091 P17 84.077 111.518 68.878 111.545 0.000 0.096 0.090 0.232 0.100 0.115 0.095 0.094 P18 257.393 185.494 199.733 185.395 247.608 0.000 0.094 0.206 0.156 0.097 0.097 0.091 P19 341.271 266.155 293.889 266.143 352.536 121.514 0.000 0.154 0.024 0.018 0.029 0.009 P20 166.455 46.169 128.776 92.379 195.463 123.627 177.363 0.000 0.018 0.017 0.028 0.008 P21 437.295 352.559 446.745 404.053 510.539 441.607 381.901 355.899 0.000 0.100 0.090 0.094 P22 518.364 430.732 526.568 483.493 590.942 508.314 436.324 430.933 82.506 0.000 0.099 0.090 P23 564.382 461.774 562.455 518.883 629.691 508.818 418.347 452.369 152.414 101.020 0.000 0.096 P24 131.412 20.202 97.204 58.386 165.387 146.899 211.513 34.708 368.508 443.241 475.439 0.000
Tools
Get Citation
Copy Citation Text
Yang WANG, Dan YUE, Xinzhi LI. Genetic Diversity of Toona ciliata Populations based on SSR Markers[J]. Journal of Resources and Ecology, 2020, 11(5): 466
Paper Information
Category: Forest Ecosystem
Received: Feb. 19, 2020
Accepted: Jun. 3, 2020
Published Online: Oct. 17, 2020
The Author Email: YUE Dan (794942134@qq.com)
© Copyright 2018-2021 | Chinese Laser Press.
All Rights Reserved 沪ICP备15018463号-20