Chinese Journal of Lasers, Volume. 51, Issue 15, 1507402(2024)

Detection of miRNA‑92a Concentration Using Terahertz Metasurface Sensors Based on Hybrid Chain Reaction

Mo Yang1、*, Shangjun Lin2, Jie Chen2, and Fangrong Hu2、**
Author Affiliations
  • 1School of Mechanical and Electrical Engineering, North China Institute of Aerospace Engineering, Langfang 065000, Hebei , China
  • 2School of Electronic Engineering and Automation, Guilin University of Electronic Technology, Guilin 541004, Guangxi , China
  • show less
    Figures & Tables(11)
    Schematic of sensor structure
    Sensor samples and spectra. (a) Microscopic image of the sensor at 500×; (b) measured spectrum
    HCR amplification process at the surface of the sensor. (a) Adding AuNP+H0 to the surface of the sensor; (b) adding miRNA-92a; (c) adding hybrid chain H1; (d) adding hybrid chain H2 based on Fig.3(c)
    Spectral comparison between bare sensor and sensor modified with AuNP+H0
    Comparison of detection with and without HCR amplification.(a) Direct detection; (b) miRNA-92a detection using HCR amplification
    Sensor sensitivity analysis. (a) Comparison of frequency shifts caused by miRNA-92a with different concentrations;
    Detection of miRNA-21. (a) Direct detection; (b) detection of miRNA-21 using HCR amplification
    Detection of miRNA339-3p. (a) Direct detection; (b) detection of miRNA339-3p using HCR amplification
    Comparison of linear fitting between concentration and frequency shift. (a) Comparison of frequency shifts caused by miRNA-21 with different concentrations; (b) comparison of frequency shifts caused by miRNA339-3p with different concentrations
    Sensitivity comparison of sensors for detecting different miRNAs
    • Table 1. miRNA and DNA chains involved in this work

      View table

      Table 1. miRNA and DNA chains involved in this work

      NameSequence (5′-3′)
      Probe (H0CAAGTGCAATAAAAAA-SH
      microRNA-92aUAUUGCACUUGUCCCGGCCUGU
      H1GGCCTGTAGGCACAGGCCGGGA
      H2GCCTACAGGCC TCCCGGCCTGT
      microRNA-21UAGCUUAUCAGACUGAUGUUGA
      microRNA-339-3pUGAGCGCCUCGACGACAGAGCCG
    Tools

    Get Citation

    Copy Citation Text

    Mo Yang, Shangjun Lin, Jie Chen, Fangrong Hu. Detection of miRNA‑92a Concentration Using Terahertz Metasurface Sensors Based on Hybrid Chain Reaction[J]. Chinese Journal of Lasers, 2024, 51(15): 1507402

    Download Citation

    EndNote(RIS)BibTexPlain Text
    Save article for my favorites
    Paper Information

    Category: Bio-Optical Sensing and Manipulation

    Received: Jan. 5, 2024

    Accepted: Mar. 11, 2024

    Published Online: Jul. 16, 2024

    The Author Email: Mo Yang (157802399@qq.com), Fangrong Hu (hufangrong@sina.com)

    DOI:10.3788/CJL240462

    CSTR:32183.14.CJL240462

    Topics