Journals Articles Conferences News About CLP
Submit a paper Email Alert
Search
Search
Articles
Journals
News
Advanced Search
Top Searches
2D MaterialsTransformation opticsQuantum PhotonicsSmall lasersSemiconductor UV PhotonicsSupersymmetric microring laser arrays

Chinese Journal of Lasers, Volume. 49, Issue 5, 0507401(2022)

Effects of Phototherapy on Learning Memory and BDNF-TrkB Signaling Pathway in Sleep-Deprived Mice

Hongli Chen1,2, Jingjing Gao2, Zhongdi Jiang2, Zhongpeng Wang1、*, Long Chen1, and Dong Ming1
Author Affiliations
  • 1Academy of Medical Engineering and Translational Medicine, Tianjin University, Tianjin 300072, China
  • 2School of Life Sciences, Tiangong University, Tianjin 300387, China
    • show less
    AbstractGet PDF(in Chinese)
    Figures&Tables (9)
    Equations (0)
    References (37)
    Cited By (1)
    Tools
    Paper Information
    Topics
    Figures & Tables(9)
    Time chart of experimental flow

    Fig. 1. Time chart of experimental flow

    Download full size
    Effect of phototherapy on body weight in sleep-deprived mice (compared with the control group, *** represents PP<0.05)

    Fig. 2. Effect of phototherapy on body weight in sleep-deprived mice (compared with the control group, *** represents P<0.001; compared with s-dep group, #represents P<0.05)

    Download full size
    Effect of phototherapy on the percentage of target quadrant time in total area time for sleep-deprived mice and trajectory diagrams of each group of mice (compared with the control group, ** represents PPP<0.01). (a) Trajectory diagram of control group mice; (b) trajectory diagram of s-dep group mice; (c) trajectory diagram of s-dep＋100 lx group mice; (d) trajectory diagram of s-dep＋300 lx group mice; (e) trajectory diagram of s-dep＋900 lx group mice; (f) effect of phototherapy on the percentage of target quadrant time in total area time for sleep-deprived mice

    Fig. 3. Effect of phototherapy on the percentage of target quadrant time in total area time for sleep-deprived mice and trajectory diagrams of each group of mice (compared with the control group, ** represents P<0.01; compared with the s-dep group, # represents P<0.05 and ## represents P<0.01). (a) Trajectory diagram of control group mice; (b) trajectory diagram of s-dep group mice; (c) trajectory diagram of s-dep＋100 lx group mice; (d) trajectory diagram of s-dep＋300 lx group mice; (e) trajectory diagram of s-dep＋900 lx group mice; (f) effect of phototherapy on the percentage of target quadrant time in total area time for sleep-deprived mice

    Download full size
    Effect of phototherapy on anxiety of sleep-deprived mice and trajectory diagrams of each group of mice (compared with the control group, *** represents PPP<0.001). (a) Trajectory diagram of control group mice; (b) trajectory diagram of s-dep group mice; (c) trajectory diagram of s-dep＋100 lx group mice; (d) trajectory diagram of s-dep＋300 lx group mice; (e) trajectory diagram of s-dep＋900 lx group mice; (f) effect of phototherapy on anxiety of sleep-deprived mice

    Fig. 4. Effect of phototherapy on anxiety of sleep-deprived mice and trajectory diagrams of each group of mice (compared with the control group, *** represents P<0.001；compared with s-dep group, # represents P<0.05 and ### represents P<0.001). (a) Trajectory diagram of control group mice; (b) trajectory diagram of s-dep group mice; (c) trajectory diagram of s-dep＋100 lx group mice; (d) trajectory diagram of s-dep＋300 lx group mice; (e) trajectory diagram of s-dep＋900 lx group mice; (f) effect of phototherapy on anxiety of sleep-deprived mice

    Download full size
    Effects of phototherapy on 5-HT expression level in plasma and hippocampus of sleep-deprived mice (compared with the control group, ** represents PPP<0.01) . (a) Plasma; (b) hippocampus

    Fig. 5. Effects of phototherapy on 5-HT expression level in plasma and hippocampus of sleep-deprived mice (compared with the control group, ** represents P<0.01; compared with s-dep group, # represents P<0.05 and ## represents P<0.01) . (a) Plasma; (b) hippocampus

    Download full size
    Effects of phototherapy on TNF-α and SOD expression levels in plasma and hippocampus of sleep-deprived mice (compared with the control group，** represents PPPP<0.01)

    Fig. 6. Effects of phototherapy on TNF-α and SOD expression levels in plasma and hippocampus of sleep-deprived mice (compared with the control group，** represents P<0.01 and *** represents P<0.001; compared with s-dep group, # represents P<0.05 and ## represents P<0.01)

    Download full size
    Effects of phototherapy on mRNA expression levels of BDNF, TrkB, and Akt in sleep-deprived mice (compared with the control group, * represents PPPP<0.01)

    Fig. 7. Effects of phototherapy on mRNA expression levels of BDNF, TrkB, and Akt in sleep-deprived mice (compared with the control group, * represents P<0.05 and ** represents P<0.01; compared with s-dep group, # represents P<0.05 and ## represents P<0.01)

    Download full size

    • Table 1. Primer sequence

      View table

      Table 1. Primer sequence

      Gene nameUpstream primer sequence(5’-3’)Downstream primer sequence(5’-3’)
      BDNFTCATACTTCGGTTGCATGAAGGACACCTGGGTAGGCCAAGTT
      TrkBCTGGGGCTTATGCCTGCTGAGGCTCAGTACACCAAATCCTA
      AktATGAACGACGTAGCCATTGTGTTGTAGCCAATAAAGGTGCCAT
      GAPDHTGGCACCCAGCACAATGAACTAAGTCATAGTCCGCCTAGAAGCA

    • Table 2. Effect of phototherapy on swimming latency and platform crossing times in sleep-deprived mice

      View table

      Table 2. Effect of phototherapy on swimming latency and platform crossing times in sleep-deprived mice

      GroupSwimming latency time /sPlatform crossing times (n)
      Control10.67±1.534.33±1.53
      s-dep44.33±7.64*1.33±0.58*
      s-dep＋100 lx31.67±21.362.67±1.15
      s-dep＋300 lx17.33±6.81#3.00±1.00#
      s-dep＋900 lx43.667±3.511.67±0.58
    Tools

    Get Citation

    Copy Citation Text

    Hongli Chen, Jingjing Gao, Zhongdi Jiang, Zhongpeng Wang, Long Chen, Dong Ming. Effects of Phototherapy on Learning Memory and BDNF-TrkB Signaling Pathway in Sleep-Deprived Mice[J]. Chinese Journal of Lasers, 2022, 49(5): 0507401

    Download Citation

    EndNote(RIS)BibTexPlain Text
    Set citation alerts for article
    Save article for my favorites
    Paper Information

    Received: Nov. 2, 2021

    Accepted: Dec. 29, 2021

    Published Online: Mar. 9, 2022

    The Author Email: Zhongpeng Wang (tunerl_wzp1@tju.edu.cn)

    DOI:10.3788/CJL202249.0507401

    Topics

    laser devices and laser physics
    Lasers and Laser Optics
    Laser physics
    laser manufacturing
    Instrumentation, Measurement and Metrology