Microfluidic Chip Based Nucleic Acid Analyzer and Its Application in Precision Medicine

Huang Shiguang; Jin Xiangyu; Lin Rongzan; Lin Xue; Xue Ning; Fan Yunqian; Zu Guo; Ma Li; Luo Xianbo; Huang Guoliang

doi:10.3788/CJL201845.0307002

Chinese Journal of Lasers, Volume. 45, Issue 3, 307002(2018)

Microfluidic Chip Based Nucleic Acid Analyzer and Its Application in Precision Medicine

Huang Shiguang^1,2,3、*, Jin Xiangyu¹, Lin Rongzan¹, Lin Xue¹, Xue Ning¹, Fan Yunqian¹, Zu Guo¹, Ma Li⁴, Luo Xianbo⁴, and Huang Guoliang^1,4

Author Affiliations

¹[in Chinese]

²[in Chinese]

³[in Chinese]

⁴[in Chinese]

show less

Abstract Get PDF(in Chinese)

Figures & Tables(8)

Fig. 1. Principle diagram of isothermal nucleic acid amplification. (a) Initialization phase; (b) circulatory phase

Download full size

Fig. 2. Structural diagram of microfluidic chip with 24 channels

Download full size

Fig. 3. Schematic diagram of nucleic acid analyzer

Download full size

Fig. 4. (a)(b) Photos of micro-fluidic chip based nucleic acid analyzer; (c) photo of micro-fluidic chip kit

Download full size

Fig. 5. Results of microfluidic chip based isothermal nucleic acid amplification. (a) Result of sensitivity test; (b) result of linearity test; (c) result of specificity test

Download full size

Table 1. Example for gene-specific probes of pathogenic bacteria

View table

Table 1. Example for gene-specific probes of pathogenic bacteria

Testing index	Probe code	Base sequence of probe
Mycoplasmapneumonia	F3	CTCACCGTAGTGGGACA
	B3	GCCCCGGGATTTTCACC
	FIP	CGTCAGGGCGGGTGTAGCTCTTCACAAGTACCACCACGAC
	BIP	TGCGCCACACCAATGCCATGGGAGGGAGGAAAAGCT
	LF	ATTGCTGGCGCTTGAGC
	LB	CGCGCTTAACCCCGTGA

Table 2. Results of clinical sample test

View table

Table 2. Results of clinical sample test

Test index	Result fromdevelopedanalyzer	Result from ABI 7500			Positivecoincidencerate /%	Negativecoincidencerate /%	Totalcoincidencerate /%
Test index	Result fromdevelopedanalyzer				PositiveNo.	NegativeNo.	SubtotalNo.
	Positive No.	23	1	24
Sau	Negative No.	0	76	76	100	98.7	99.0
	Subtotal No.	23	77	100
	Positive No.	22	1	23
MRSA	Negative No.	0	77	77	100	98.7	99.0
	Subtotal No.	22	78	100
	Positive No.	14	1	15
Mpn	Negative No.	1	84	85	93.3	98.8	98.0
	Subtotal No.	15	85	100
	Positive No.	59	3	62
Total	Negative No.	1	237	238	98.3	98.8	98.7
	Subtotal No.	60	240	300

Table 3. Analysis of discrepancy samples of test result
View table
Table 3. Analysis of discrepancy samples of test result
Sample No. ABI 7500 Developedanalyzer Reanalysisby ABI 7500 Reanalysis bydeveloped analyzer Sequencing
22 Mpn Sau Mpn Sau Sau
32 Sau Sau, MRSA Sau Sau, MRSA Sau, MRSA

Tools

Get Citation

Copy Citation Text

Huang Shiguang, Jin Xiangyu, Lin Rongzan, Lin Xue, Xue Ning, Fan Yunqian, Zu Guo, Ma Li, Luo Xianbo, Huang Guoliang. Microfluidic Chip Based Nucleic Acid Analyzer and Its Application in Precision Medicine[J]. Chinese Journal of Lasers, 2018, 45(3): 307002

Download Citation

EndNote(RIS)BibTex Plain Text

Set citation alerts for article

Save article for my favorites