The Journal of Light Scattering, Volume. 32, Issue 4, 306(2020)

Optimization of surface enhanced Raman scattering detection conditionsfor single-stranded DNA

JIANG Chengshun1、*, LI Wang2, LIU Yan2, and LU Feng1,2
Author Affiliations
  • 1[in Chinese]
  • 2[in Chinese]
  • show less

    Objective: Studying the optimal detection conditions of surface-enhanced Raman Spectroscopy (SERS) for single-stranded deoxyribonucleic Acid (ssDNA).Method: ssDNA GO18(AACCTTTGGTCGGGCAAGGTAGGTT(5′~3′))is used as an example to explore the influence of different detection conditions (concentration of silver sol, laser power and integration time, sample loading method, dosage of coagulant MgSO4) on the results of SERS detection. Under the optimal detection conditions, the stability, repeatability, and detection limit were investigated, and the peak positions of the spectra were assigned.Result: The best conditions for determining ssDNA were as follows: silver sol was concentrated 100 times, laser power was 30% (60 mW), integration time was 30 s, the sample was loaded in 1.0-0.8 high-purity quartz capillary and the amount of MgSO4 (10mM) was 2.0μL. The measurement results under these conditions have high stability and good repeatability, and the detection limit is 0.625μM.Conclusion: This study optimized SERS detection conditions for ssDNA and provided a method basis for further expanding and promoting the application of SERS technology in the field.

    Tools

    Get Citation

    Copy Citation Text

    JIANG Chengshun, LI Wang, LIU Yan, LU Feng. Optimization of surface enhanced Raman scattering detection conditionsfor single-stranded DNA[J]. The Journal of Light Scattering, 2020, 32(4): 306

    Download Citation

    EndNote(RIS)BibTexPlain Text
    Save article for my favorites
    Paper Information

    Category:

    Received: May. 25, 2020

    Accepted: --

    Published Online: Apr. 12, 2021

    The Author Email: JIANG Chengshun (1162290696@qq.com)

    DOI:10.13883/j.issn1004-5929.202004003

    Topics