Journals Articles Conferences News About CLP
Submit a paper Email Alert
Search
Search
Articles
Journals
News
Advanced Search
Top Searches
2D MaterialsTransformation opticsQuantum PhotonicsSmall lasersSemiconductor UV PhotonicsSupersymmetric microring laser arrays

Journal of Inorganic Materials, Volume. 38, Issue 7, 830(2023)

In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation

Wei WU1,2, Shahd BAKHET2, Naomi Addai ASANTE2, Shefiu KAREEM2, Omar Ramadhan KOMBO3, Binbin LI2, and Honglian DAI1,2、*
Author Affiliations
  • 11. Shenzhen Institute of Wuhan University of Technology, Shenzhen 518000, China
  • 22. State Key Laboratory of Advanced Technology for Materials Synthesis and Processing, Biomedical Materials and Engineering Research Center of Hubei Province, Wuhan University of Technology, Wuhan 430070, China
  • 33. Department of Medical Science and Technology, Mbeya University of Science and Technology, Mbeya, Tanzania
    • show less
    Full TextGet PDF
    Figures&Tables (11)
    Equations (0)
    References (43)
    Tools
    Paper Information
    Topics
    Figures & Tables(11)
    XRD patterns of prepared TCP/TMP composite materials
    1. XRD patterns of prepared TCP/TMP composite materials

    Download full size
    View in Article
    SEM images of different microsphere composites with insets showing their corresponding particle size distributions(a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP
    2. SEM images of different microsphere composites with insets showing their corresponding particle size distributions(a)TCP; (b) 25% TMP; (c) 50% TMP; (d) 75% TMP; (e) TMP

    Download full size
    View in Article
    TG/DTA/DTG curves of microspheres prepared by water in oil emulsion cross-linking method(a) TCP; (b) 25%TMP; (c) 50%TMP; (d) 75%TMP; (e) TMP
    3. TG/DTA/DTG curves of microspheres prepared by water in oil emulsion cross-linking method(a) TCP; (b) 25%TMP; (c) 50%TMP; (d) 75%TMP; (e) TMP

    Download full size
    View in Article
    Released Ca2+and Mg2+ concentrations from materials immersed in tris-HCl solution
    4. Released Ca2+and Mg2+ concentrations from materials immersed in tris-HCl solution

    Download full size
    View in Article
    Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay(a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p p p < 0.0002; Colorful figures are available on website
    5. Cell viabilities of (a) MC3T3-E1 and (b) HUVECs assessed by CCK-8 assay(a) MC3T3-E1 and (b) HUVECs assayed on day 1, 3, 5 cultured with different microspheres concentration extracts *: p < 0.01; **: p < 0.005; ***: p < 0.0002; Colorful figures are available on website

    Download full size
    View in Article
    ALP activity and ARS staining of MC3T3-E1 cells cultured with microspheres extract compared with the control on the 7th and 14th day
    6. ALP activity and ARS staining of MC3T3-E1 cells cultured with microspheres extract compared with the control on the 7th and 14th day

    Download full size
    View in Article
    (a) VEGF and (b) FGF of HUVECs cultured with microspheres extracts on the 1st and 3rd day
    7. (a) VEGF and (b) FGF of HUVECs cultured with microspheres extracts on the 1st and 3rd day

    Download full size
    View in Article
    (a) COLI and (b) OPN genes expression of MC3T3-E1 which cultured with microspheres extract compared to the control on the 3rd and 7th day
    8. (a) COLI and (b) OPN genes expression of MC3T3-E1 which cultured with microspheres extract compared to the control on the 3rd and 7th day

    Download full size
    View in Article
    SEM images of different microsphere composites with Bars at 200 μm (up row) and 10 μm (down row)
    S1. SEM images of different microsphere composites with Bars at 200 μm (up row) and 10 μm (down row)

    Download full size
    View in Article
    XRD patterns of TMP (a) and β-TCP (b)
    S2. XRD patterns of TMP (a) and β-TCP (b)

    Download full size
    View in Article

    • Table 1.

      Primer sequences used in RT-qPCR

      View table
      View in Article

      Table 1.

      Primer sequences used in RT-qPCR

      GenePrimer sequence
      VEGFAGGAGTACCCCGACGAGATAGACACATCTGCTGTGCTGTAGGAA
      FGFACAGGAGCGACCAGCACATTTTGGTGTCTGCGAGCCGTAT
      COL ICACTGCAAGAACAGCGTAGCAAGTTCCGGTGTGACTCGTG
      OPNACACTTTCACTCCAATCGTCCCTACGGACTCCTTAGACTCACCGCTCTT
    Tools

    Get Citation

    Copy Citation Text

    Wei WU, Shahd BAKHET, Naomi Addai ASANTE, Shefiu KAREEM, Omar Ramadhan KOMBO, Binbin LI, Honglian DAI. In vitro Study of Biphasic Calcium Magnesium Phosphate Microspheres for Angiogenesis and Bone Formation [J]. Journal of Inorganic Materials, 2023, 38(7): 830

    Download Citation

    EndNote(RIS)BibTexPlain Text
    Set citation alerts for article
    Save article for my favorites
    Paper Information

    Category:

    Received: Nov. 5, 2022

    Accepted: --

    Published Online: Dec. 28, 2023

    The Author Email: DAI Honglian (daihonglian@whut.edu.cn)

    DOI:10.15541/jim20220662

    Topics

    laser devices and laser physics
    Lasers and Laser Optics
    Laser physics
    laser manufacturing
    Instrumentation, Measurement and Metrology