Journal of Inorganic Materials, Volume. 36, Issue 12, 1316(2021)

Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility

Dawei ZHANG1... Liyuan ZHU2, Hongliang LU2 and Zuolin WANG1,* |Show fewer author(s)
Author Affiliations
  • 11. Shanghai Engineering Research Center of Tooth Restoration and Regeneration, Department of Implantology, School & Hospital of Stomatology, Tongji University, Shanghai 200072, China
  • 22. State Key Laboratory of ASIC and System, Shanghai Institute of Intelligent Electronics & Systems, School of Microelectronics, Fudan University, Shanghai 200433, China
  • show less
    Figures & Tables(10)
    (a) Schematic diagram of fabrication progress of Ti/ZnO and Ti/ZnO/Fn, and SEM images of (b, e) Ti, (c, f) Ti/ZnO and (d, g) Ti/ZnO/Fn at low (b-d) and high (e-g) magnification
    (a) XPS spectra of Ti, Ti/ZnO, and Ti/ZnO/Fn, (b) high-resolution spectra of N1s peak of Ti, Ti/ZnO, Ti/ZnO/APTES, and Ti/ZnO/Fn, and (c) FT-IR spectra of Ti/ZnO/APTES and Ti/ZnO/Fn Ti/ZnO/APTES: Ti disc with ZnO nanofilm modified with APTES
    Antibacterial effects and mechanisms of Ti, Ti/ZnO, and Ti/ZnO/Fn against A. a and P. g for 24 h
    Cytocompatibility of Ti/ZnO/Fn on human gingival fibroblasts
    Quantification of the gene expression of (a) Col1, (b) Col3 and (c) ITGB1a in hGFs on Ti, Ti/ZnO and Ti/ZnO/Fn for 3 d by qPCR
    (a) Sagittal pictures of Micro-CT, (b) H&E-stained tissues around screws, and (c) quantification of the gene expression of IL1β, Arg1, TNFα, IL4, and TGFβ1 by qPCR in gingiva tissues around Ti, Ti/ZnO and Ti/ZnO/Fn screws after being inserted into maxillae of rats for 4 w
    Reactive oxygen species (ROS) detected by fluorescence probes in bacteria cultured on materials for 24 h
    • Table 1. Specific forward and reverse primer sequences of detected genes of HGFs

      View table
      View in Article

      Table 1. Specific forward and reverse primer sequences of detected genes of HGFs

      GeneForward primer sequence (5′-3′)Reverse primer sequence (3′-5′)
      GAPDHGCACCGTCAAGGCTGAGAACTGGTGAAGACGCCAGTGGA
      Col1TCTAGACATGTTCAGCTTTGTGGACTCTGTACGCAGGTGATTGGTG
      Col3GCAAATTCACCTACACAGTTCTGGACTTGATCAGGACCACCAATGTCATA
      ITGB1αTGTGTCAGACCTGCCTTGGTGAGGAACATTCCTGTGTGCATGTG
    • Table 2. Specific forward and reverse primer sequences of detected genes of rat

      View table
      View in Article

      Table 2. Specific forward and reverse primer sequences of detected genes of rat

      GeneForward primer sequence (5′-3′)Reverse primer sequence (3′-5′)
      GAPDHCCCCAATGTATCCGTTGTGCTCAGTGTAGCCCAGGATGC
      IL1βGACCTGTTCTTTGAGGCTGACACTCATCTGGACAGCCCAAGTC
      Arg1AGCAGAGACCCAGAAGAATGTTTCCTTTCAGTTCCTTCAG
      TNFαGACAAGGCTGCCCCGACTATGGGAGACTCCTCCCAGGTACA
      IL4TCGCTTGCCTTGGTGGTCTGTGATGTTGCTCAGCTCCTC
      TGFβ1AGGACCTGGGTTGGAAGTGGAGTTGGCATGGTAGCCCTTG
    • Table 3. Elemental chemical composition of Ti, Ti/ZnO and Ti/ZnO/Fn

      View table
      View in Article

      Table 3. Elemental chemical composition of Ti, Ti/ZnO and Ti/ZnO/Fn

      SampleC1s/%O1s/%N1s/%Si2p3/%Ti2p3/%Zn2p3/%
      Ti57.6931.071.920.029.260.05
      Ti/ZnO38.9437.222.260.081.0720.44
      Ti/ZnO/Fn63.9121.211.882.270.130.6
    Tools

    Get Citation

    Copy Citation Text

    Dawei ZHANG, Liyuan ZHU, Hongliang LU, Zuolin WANG. Titanium Modified with ZnO Nanofilm and Fibronectin: Preventing Peri-implantitis and Biocompatibility[J]. Journal of Inorganic Materials, 2021, 36(12): 1316

    Download Citation

    EndNote(RIS)BibTexPlain Text
    Save article for my favorites
    Paper Information

    Category: RESEARCH ARTICLE

    Received: Mar. 3, 2021

    Accepted: --

    Published Online: Sep. 16, 2022

    The Author Email: WANG Zuolin (zuolin@tongji.edu.cn)

    DOI:10.15541/jim20210125

    Topics